The sjTREC Frequency as an Estimate of Thymic Function

As TRECs are stable molecules that are only diluted during cell proliferation, the sjTREC, a unique molecule generated in the majority of differentiating thymocytes, has been used for several years as a surrogate marker for thymic function. Several studies have demonstrated that in animal models, such as the chicken and mouse, as well as in healthy human subjects, the frequency of circulating sjTREC cells correlates with thymic activity 4,11-17 . In addition, as expected from the observations...

Hannah Stewart Rommel Ravanan and Richard Smith

Experimental models of transplantation remain essential tools for the study of immunological tolerance. The immunological mechanisms resulting in acute allograft rejection may differ depending on the tissue transplanted and the antigenic mismatch between donor and recipient. Murine skin grafting is a model frequently used to study transplantation tolerance because it is readily learned and is not time consuming. Second grafts can be performed easily to confirm the induction of tolerance and its...

Preparation of Exosomes From Bone MarrowDerived DC

3.1.1. DC Generation From Bone Marrow Cells The following method for bone marrow DC generation has been adapted 1. Sacrifice the mice in a CO2 chamber. Bone marrow from 10 mice will yield approx 10 g of exosomes. 2. Swab the mice with 70 EtOH. 3. Disinfect the scissors and forceps using 70 EtOH. 4. Make a transverse incision across the abdomen and deflect the skin to expose the entire hind limb. 5. Dissect the femur and tibia bilaterally by cutting the joints and removing as much muscle as...

DC and T Cell Preparation

BMDC are generated in 8-d cultures as previously described 16 . 1. Sacrifice mice by cervical dislocation. 2. Remove femur and tibia surgically and free from adhering fat and muscle tissue. 3. Open bones carefully by removing the proximal and distal ends with small scissors. 4. Flush each marrow cavity into an empty Petri dish with approx 5 mL of PBS 1 FCS using a 27-gauge needle. 5. Transform the resulting solution to a single cell suspension by performing several strokes up and down a 1-mL...

Ludovica Bruno

Dendritic cells DC are key regulators of the immune system. They are capable of stimulating lymphocytes to generate potent cell-mediated and humoral immune responses against pathogens and tumor cells. DC not only activate lymphocytes, but can also educate T cells to tolerate self-antigens, thereby minimizing autoimmune reactions. Another peculiarity of the DC system is the large variety of subsets described, both in the human and in the mouse, according to surface phenotype and organ...

Elena Shklovskaya and Barbara Fazekas de St Groth Summary

The interaction between dendritic cells and T cells is crucial for the regulation of immunological tolerance and immunity. Although our understanding of the mechanisms responsible for these phenomena has advanced significantly in recent years, we are still lacking a fully integrated model of how dendritic cell phenotype correlates with function, and how complex interactions with multiple dendritic and T cell subpopulations shape the course of the immune response in vivo. In this review, we...

Frances T Hakim and Ronald E Gress Summary

The thymus contributes to the regulation of tolerance and the prevention of autoimmunity at many levels. First, auto-reactive CD4 and CD8 T cells are clonally deleted during negative selection in the thymus, establishing central tolerance. The unique expression of the AIRE autoimmune regulator gene in medullary thymic epithelial cells results in expression of a broad array of tissue-specific antigens. Thymocytes bearing T-cell receptors that bind to these tissue-specific antigens are clonally...

DC Development In Vivo and In Vitro

DC development in vivo has been studied extensively in the mouse. Both BM myeloid-committed precursors common myeloid precursors CMPs , lineage and lymphoid-committed precursors common lymphoid precursors CLPs , Lin-Thy1Sca-1mtIL-7Ra ckitmt can give rise to DCs upon transfer into lethally irradiated animals 34,35 . In addition, thymic precursors that are committed to the lymphoid lineage CD4lowThy1hlghckit can provide transient DC reconstitution after transfer into irradiated hosts 34-36 . It...

Distribution and Phenotype of DCs

DCs are strategically located at places where they can capture antigen and or meet T cells for antigen presentation body surfaces epithelia of skin, airways, and gut , interstitial spaces of many organs, central and secondary lymphoid organs as well as blood and afferent lymphatics. Most peripheral DCs have a short life span 3-5 d and are therefore continuously replaced from blood-borne precursors 17 . A circulating population of committed DC precursors has been defined in human 18,19 and mouse...

Notes Avt

1. The peptide concentration can vary greatly depending on the type of antigen presenting cell used, the nature of the antigen, and possibly also the experimental readout. For OVA323-339, DC require 0.1-1 g mL of peptide to induce maximal T-cell proliferation, whereas resting B cells need 100 ig mL for maximum responses 4 . In contrast, amounts as little as 10 ng mL can be optimal for DC-presentation of a peptide like SIINFEKL, the cognate antigen for the TCR transgenic line, OT-I. Although...

MarieLise Dion RafickPierre Skaly and Rmi Cheynier Summary

Analysis of immune reconstitution is of major importance in clinical settings such as following bone marrow transplantation or during anti-retroviral treatment of HIV-infected patients. In these patients, thymic function is essential for the reconstitution of a diversified T-cell receptor TCR repertoire. During thymopoiesis, several genetic rearrangements lead to the generation of fully functional TCR. By-products of these processes, the T-cell receptor excision circles TRECs , are present in...

The 3D Collagen Matrix Chamber Buildup and Cell Loading

3.2.1. Preparing the Paraffin Mix 1. In a heat stable beaker, mix one part of petroleum jelly Vaseline with eight parts of paraffin. 2. Heat to 60 C. This will result in a clear solution that can be used for chamber building using a paint-brush. 3. The solution can be repeatedly reheated and used many times. 3.2.2. Building the Collagen Gel Chamber The microscope slide is painted with heated paraffin mix to create a U-shaped wall structure see Fig. 1 . Cover Slip Fig. 1. Construction of a...

Intracellular Staining for Cytokines and the Foxp3 Transcription Factor

1. Phorbol myristate acetate PMA and ionomycin both Sigma prepared individually at 1 mg mL in ethanol and stored at -20 C. Make 100X stocks 5 g mL for PMA, 100 g mL for ionomycin in wash buffer see Subheading 2.2. and store at -20 C. The final working concentrations are 50 ng mL PMA and 1 g mL ionomycin, made freshly from these 100X stocks. 3. 2 Paraformaldehyde prepared by the following protocol add 2 g of paraformaldehyde to 50 mL ddH20 and heat to 60 C for 15 min. Add a few drops of 1 M NaOH...

AgeDependent Thymic Involution

The thymus attains its greatest size and cellularity in the late fetal and early neonatal period. By computerized tomography, the thymic profile is largest in From Methods in Molecular Biology, vol. 380 Immunological Tolerance Methods and Protocols Edited by P. J. Fairchild Humana Press Inc., Totowa, NJ young children, but declines markedly with age 7 . The radiodense parenchyma dwindles and is gradually replaced with diffuse strands in middle-aged adults frequently, in older individuals no...

Administration of TumorAssociated Antigen and CpG to Flt3L Treated Animals

2.1.1. Flt3-L and Vaccine Preparation 1. Recombinant human Flt3-ligand Peprotech reconstitute in sterile PBS and keep at 4 C for up to 1 wk. Aliquots of reconstituted Flt3-ligand may be stored at -70 C for several months prior to use but repetitive freezing and thawing should be avoided. 2. Phosphorothioate-stabilized Oligonucleotides synthesized by Oligos Etc. Inc., Wilsonville, OR Stimulating CpG 1826 TCCATGACGTTCCTGACGTT Control oligonucleotide TCCAGGACTTTCCTCAGGTT Oligonucleotides are...

Binding of mRNA to Magnetic Beads and Synthesis of cDNA

In the original description of SAGE 1 , poly A mRNA was isolated using oligo dT -coated magnetic beads, eluted and cDNA synthesis performed in solution, primed using a biotinylated oligo dT primer. Following Nla III digestion, a further magnetic isolation was required to purify the 3' cDNA restriction fragments. The efficiency of this process has now been improved by the introduction of an on-bead cDNA synthesis procedure see Notes 5 and 7 . 1. Magnetically isolate 60 L of oligo dT -coated...

Ines Mende and Edgar G Engleman Summary

Dendritic cells DC are extremely potent antigen-presenting cells, which can prime both na ve CD4 and CD8 T lymphocytes. In their immature state, DC continuously sample and process antigens from the surrounding environment, but only mature DC express sufficient levels of costimulatory molecules to activate na ve T cells. DC present in tumors are functionally immature owing to the immunosuppressive actions of tumor-derived factors and regulatory T cells, and such immature DC promote immune...

Islet Transplantation

Wax Microscope

Islet isolation techniques differ between laboratories but all rely on collagenase digestion of the pancreas to generate a cell suspension containing exocrine tissue and intact islets of Langerhans 1 of total tissue . Over-digestion results in fragmentation of islets because of disruption of the islet capsule the function of such islets will be compromised. Under-digestion results in exocrine tissue remaining attached to the islets referred to as embedded islets . We routinely isolate islets...

Immunofluorescence Confocal Microscopy

1. Confocal microscope A Zeiss LSM 510 confocal microscope, equipped with a x64 1.4 NA Plan-Apochromat oil-immersion lens. Ar-laser liner at 488 nm is used for excitation of fluorescein isothiocyanate FITC or Alexa 488. On the other hand, He-Ne laser liner at 545 nm is used for excitation of rhodamine or Alexa 543. Emission wavelengths are separated by band pass 505-530 nm and long pass 585 nm filters, respectively. 2. Glass slides eight-hole heavy Teflon-coated slides Bokusui Brown, New York,...

Molecular Regulation of Thymus Development

Current understanding of the molecular mechanisms that govern the early stages of thymus organogenesis has come primarily from analysis of mice carrying classical or engineered mutations. The key molecules see Fig. 4 identified via these studies are reviewed below. 2.3.1. Transcription Factors 2.3.1.1. Tbx1 Tbx1 is a T-box related transcription factor and is expressed from E7.5 to E12.5 in a variety of structures during development, including the pharyngeal Fig. 4. Continued pink , whereas the...

Generation of TREC Molecules

As mentioned above, during the thymocyte maturation process, highly diverse TCR molecules are generated to ensure that all T cells leaving the thymus harbor a specific TCR endowed with a unique antigenic specificity. Such diversity is made possible through multiple chromosomal rearrangements both at the TCRB and TCRA loci. At the TCRB locus, two subsequent genetic rearrangements occur. The fusion of a DP diversity segment with a JP junction segment, followed by the junction of a VP variable...

Cellular Events in Thymus Organogenesis

2.1.1. Cellular Regulation of Early Thymus Organogenesis Thymus organogenesis occurs in the pharyngeal region of the developing embryo. This region is composed of a number of bilateral bulges known as pha-ryngeal arches, which are separated by structures known as pharyngeal pouches and pharyngeal clefts. The pharyngeal pouches are bilateral outpocketings of pharyngeal endoderm, which form sequentially in a rostral to caudal manner and initially comprise a single layer of simple epithelium,...

Preparation of the Popliteal LN

For all the following steps, the mouse should be transferred to the heated platform see Fig 1A . The use of this stage simplifies the management of the mouse during the preparation of the sample and contributes to the overall stability of the intravital setup. 1. Shave the hair of the left lower hind leg using a small animal clipper. 2. Tape the tail of the mouse to the right side of the body using surgical tape. The left lower hind leg is gently pulled out and kept in extension using surgical...

Cellular Interactions During Thymus Organogenesis

Pharyngeal Endoderm Thymus

2.2.1. Epithelial Mesenchymal Interactions The essential role of NCC in thymus organogenesis was demonstrated by the perturbed development of TEC in E12.5 thymic lobes cultured in the absence of the mesenchymal capsule 87 . In addition, ablation of the migratory capacity of NCC, by artificially induced lesions in chick embryos 88 results in thymic aplasia or hypoplasia. However, although NCC are likely to be important in early stages of thymus formation, no functional role has been demonstrated...

Preparative PCR Amplification of Ditags see Note 28

Use the conditions determined in Subheading 3.7. to provide sufficient quantities of ditags for concatenation and SAGE library construction. 1. For scale-up to 5 mL 50X 100- L PCR reactions , prepare hot start PCR mix as follows 500 L of 10X PCR buffer, 470 L of 50 mM MgCl2, 75 L of each 100 mM dNTP, 300 L of DMSO, 10 L of each 500 M biotinylated long SAGE primer, and 910 L of sterile water. 2. Transfer 50 L of the hot-start PCR premix to one well of a 96-well PCR plate to serve as the...

In Vitro Analysis of AntigenInduced TCell Proliferation by CFSEDilution

This protocol provides a means to determine division of cells expressing a particular marker of interest e.g., CD4 vs CD8, or a congenic CD45 or CD90 marker using flow cytometry. Cells are loaded with CFSE ex vivo. As they divide, the dye is distributed equally into the two daughter cells, which therefore have half the fluorescence intensity. Both the number of cells entering mitosis and the number of divisions up to nine can be assessed. 1. Lymph node and or spleen cells are prepared as...

Expanding DC In Vivo With Flt3L Followed by Administration of a TumorAssociated

3.1.1. Preparation and Use of Flt3-L a. Flt3-L is reconstituted in sterile PBS at 50 g mL. Fill syringe with Flt3-L, expel any air bubbles and inject 200 L into the peritoneum of 6- to 8-wk-old Overview of the Animal Models in Which the Flt3-L Antigen CpG Combination Strategy has Been Successfully Used for Tumor Therapy cell line Tumor dose Tumor antigen Mouse strain Relevant MHC CTL epitope Reference Overview of the Animal Models in Which the Flt3-L Antigen CpG Combination Strategy has Been...

Introduction Ktr

Experimental autoimmune encephalomyelitis EAE is a commonly used immune-mediated disease characterized by inflammation and demyelination of the central nervous system CNS and, as such, serves as an animal model multiple sclerosis 1 . EAE can be induced in several species of laboratory animal here, we shall focus on mouse models by active immunization with autoantigens derived from CNS myelin, emulsified in complete Freund's adjuvant. The disease is essentially driven by the activation of...

Mandy J McGeachy Richard OConnor Leigh A Stephens and Stephen M Anderton

Experimental autoimmune encephalomyelitis is a long-established mouse model of multiple sclerosis. The requirements for autoreactive T-cell activation in this disease have been characterized extensively and novel strategies for immune-intervention are being developed continually. Notably, identification of immunodominant T-cell epitopes allows the induction of T-cell tolerance with synthetic peptides. Several transgenic mouse lines that express transgenic T-cell receptors recognizing myelin...

Nadia Giarratana Giuseppe Penna and Luciano Adorini Summary

The nonobese diabetic NOD mouse represents probably the best spontaneous model for a human autoimmune disease. It has provided not only essential information on type 1 diabetes T1D pathogenesis, but also valuable insights into mechanisms of immunoregulation and tolerance. Importantly, it allows testing of immunointervention strategies potentially applicable to man. The fact that T1D incidence in the NOD mouse is sensitive to environmental conditions, and responds, sometimes dramatically, to...

Visualization of Exosomes Using Electron Microscopy 1

Exosomes 10 L purified by differential ultracentrifugation and resuspended in PBS are loaded on a Formvar carbon coated grid for 1 min, negatively stained with 10 L neutral 1 aqueous phosphotungstic acid or 1 uranylacetate for 1 min and viewed using a JEM-1011 computer controlled high contrast 80 kV transmission electron microscope. Exosomes are typically 50-120 nm in diameter and appear saucer shaped. Figure 2 shows an electron micrograph of exosomes secreted from unmodified DC. Resuspend...

Visualization of Exosomes Using Electron Microscopy

1. Formvar carbon coated EM grid. 2. Neutral 1 aqueous phosphotungstic acid or 1 uranylacetate. 3. Transmission electron microscope JEOL-1210 computer controlled high contrast 120 kv transmission electron microscope . 2.3. In Vitro Characterization of Exosomes 1. 5X protein loading sample buffer 1 g SDS, 5 mg bromophenol blue, 5 mL glycerol, 2.5 mL Tris-HCl, pH 6.8, 2.8 mL 2-mercaptoethanol. 2. Nitrocellulose or polyvinylidene fluoride PVDF . 4. 10X SDS running buffer 144 g glycine, 30.2 g...

Eli Sercarz and Claudia RajaGabaglia Summary

Despite central and peripheral regulatory mechanisms designed to prevent self-reactivity, autoimmune disease is a common condition. This article explores several ways in which both high and low affinity T cells can avoid negative selection. The concept of intramolecular sequestration indicates that there will be a hierarchy of presentation of different antigenic determinants derived from a protein antigen, such that some determinants will be efficiently presented whereas others will be poorly...

Index

Activation induced cell death AICD , 418 Adenovirus, 445 Adhesion molecules, 409 Adjuvant, 32, 411, 432 complete Freund's, 313, 315, 318, 411,446 incomplete Freund's, 278, 315, 410 Adjuvant arthritis, 280 Affymetrix chips, 219, 221 Allograft rejection, 337 recognition, 338 indirect pathway of alloantigen recognition, 338 Alloxan, 288 Anchor enzyme, 226 cleavage of cDNA, 229, 235 Androgen blockade, 379 Anergy in B cell tolerance, 10 in T cell tolerance, 31, 167, 216, 272 of Treg cells, 84...

In Vitro Characterization of Exosomes

For Western blot, exosomes 3-10 pg are separated by 12 or 15 sodium dodecyl sulfate-polyacrylamide gels, semidry transferred onto PVDF and detected by Western blotting using an enhanced chemiluminescence detection kit. Exosomal proteins for which we routinely blot include Hsc70, CD71, and major histocompatibility complex class II. The basic protocol is as follows 1. Dilute the exosomes in 5X sodium dodecyl sulfate sample buffer. 2. Boil the samples for 5 min at 95 C and load onto a sodium...

In Vitro and In Vivo Functional Testing of Exosomes

To test the ability of DC-derived exosomes to suppress T-cell proliferation, the effect of adding DC-derived exosomes to a MLR is tested. T cells are purified from the spleens of BALB c mice for in vitro micro-culture in round-bottomed 96-well plates. In each well, 5 x 104 splenic T cells are seeded with C57Bl 6 derived DC plus increasing concentrations of exosomes 0-2 g mL at a ratio of 10 1. On day 5 of culture, 1 Ci of 3H-thymidine is added to each well 16 h prior to harvest. Radioactive...

Immunologic Effects of Exosomes

Exosomes originating from immune cells, such as B cells, T cells, DC, and mast cells, are thought to play a role in communicating immuno-regulatory signals to other immune cells in either an immuno-stimulating or suppressive manner. Indeed, exosomes derived from immune cells express regulatory molecules to carry out this function, including major histocompatibility complex class I and II molecules, B7-1, B7-2, as well as various targeting and adhesion molecules that may dock exosomes to...

Kevin J Maloy

Although the etiology of human inflammatory bowel disease IBD has not yet been completely defined, the current prevailing hypothesis is that it is caused by aberrant immune responses, or loss of tolerance, toward components of the intestinal bacterial microflora. During the past decade, several animal models of IBD have been developed that reproduce many features of the human disease. This article will outline one of the best characterized murine IBD models, the T-cell transfer model where...

Manipulation of Cosignaling Pathways

A balance between stimulatory and inhibitory molecular signals is necessary for maintaining tolerance. Signaling through both the original and newer members of the B7-CD28 pathway provides second signals that can regulate the activation, inhibition and fine tuning of T-cell responses 96 . The five new B7 family members, PD-L1 B7-H1 , PD-L2 B7-DC , B7-H3, B7-H4, and ICOS ligand, are expressed on professional APC and regulate T-cell activation and tolerance. The novel CD28 family members, PD-1,...

Tr1 Cells

In addition to natural arising cells with suppressor activity, it has been shown clearly that other types of regulatory T cells can develop under specific but yet not completely defined conditions. Tr1 represent probably the most widely investigated population of this genre. Upon TCR-mediated activation, these cells produce high levels of IL-10 and TGF-P, IFN-y, and IL-5 a unique pattern of cytokine production . Tr1 cells were defined initially as able to prevent inflammatory bowel disease in...

Hematopoietic Cell Chimerism in Immunological Tolerance

The significance of donor cell chimerism in transplant tolerance has been recognized both clinically and experimentally for the past half century 83 , and the establishment of donor hematopoietic cells in graft recipients as a means to tolerize the recipient to donor alloAgs remains at the forefront of basic and trans-lational immune tolerance research. Hematopoietic chimerism appears to represent a key mechanism for maintenance of specific cytotoxic T-cell unresponsiveness 84 and persistence...

CD8 Regulatory T Cells

CD8 T cells were the first suppressor cells identified. Qa-1-restricted regulatory CD8 T cells 51,52 are specific for self Ag not yet identified presented by nonclassical MHC class 1b molecules Qa-1 . Interestingly, Qa-1 is expressed preferentially on activated, but not resting T cells and its surface expression is short-lived. This pattern is compatible with the observation 44 that the role of Qa-1 on regulatory CD8 T cells in the control of autoimmune disease is evident during secondary, but...