Isolation of MEF
The protocol below is a method that has worked well to produce high-quality MEFs from various mouse strains including, 129, C57B 6, FVB N, and CF-1. 1. In the animal facility using approved euthanasia method, sacrifice a 13.5 dpc female mouse. At 13.5 dpc, the female will be very visibly pregnant. 2. Place the female on her back on a clean bench or inside a hood. Spray the abdomen with 70 ethanol. Using sterile forceps and scissors make a small lateral incision under the diaphragm. With two...
Infinium genotyping
Infinium genotyping is conducted according to the Infinium User's Manual. First, whole-genome amplification is used to amplify 750 ng of genomic DNA by a factor of 1000-2000X in a relatively unbiased manner. The Infinum assay uses a pre-formulated WGA amplification kit MP1 and AMM for compatibility with downstream fragmentation and processing. Amplification proceeds at 37 C for 20h. After amplification, a fragmentation protocol is used to reduce the fragment size to 200-300 bp. This...
Culture of embryos
Preparation of embryos for hESC derivation Frozen 2PN and day 3 embryos are rapidly thawed and cultured in blastocyst culture media until they develop into blastocysts Figure 21.1 . Unless they are to be manually dissected see below , the blastocysts are allowed to hatch, or induced to hatch by applying Acid Tyrode's solution with a micropipette on day 5 or 6. Alternatively, laser-assisted hatching can be used. Embryos that were frozen at the blastocyst stage are thawed and cultured overnight...
Day 2 Making chromosome spreads
Making chromosome spreads is not necessary for FISH but this technique can be used to adhere the nuclei to the slide. 1. Let the cells warm up to room temperature and wash twice with fixative. Resuspend cells in 1 mL of fixative. Note It may be necessary to spin the cells down later and resuspend them in a smaller or larger volume of fixative, depending on how many cells you have. Try 1 mL to start and if the spreads on the slide look too sparse or too close together see step 6 , adjust the...
Differentiation of dopaminergic neurons from hESCs
1. To start dopaminergic neural differentiation, ESCs are differentiated to neuroepithelial cells under FGF2 treatment 20 ng mL in a six-well plate according to the procedure described in Chapter 14 for 10 days. 2. On day 10 primitive neuroepithelial cells characterized by their elongated, columnar morphology make up the majority of the inner cells in differentiating colonies Figure 15.1A,B . At this stage, aspirate off the medium and add 3 mL of fresh neural induction medium containing FGF8 20...
Philip H Schwartz
Children's Hospital of Orange County California, USA AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN FRANCISCO SINGAPORE SYDNEY TOKYO Academic Press is an imprint of Elsevier Academic Press is an imprint of Elsevier 360 Park Avenue South, New York, NY 10010-1710 84 Theobald's Road, London WC1X 8RR, UK 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 525 B Street, Suite 1900, San Diego, California 92101-4495, USA Copyright 2007 Elsevier Inc. All rights reserved No...
hESC medium for making MEFCM 500mL
2-Mercaptoethanol Invitrogen 55 mM solution bAdd FGF2 to medium after it has been filtered. bAdd FGF2 to medium after it has been filtered. Mix all ingredients, except FGF2, in the top of a 500mL 2mm PES filter unit. Store at 4 C. Discard unused medium after two weeks.
BD Matrigel 1
The source of this ECM mixture is the Engelbreth-Holm-Swarm mouse tumor. Its major components are laminin, collagen IV, heparan sulfate proteoglycans, and entactin. At room temperature, BD Matrigel matrix polymerizes to produce biologically active matrix material resembling the mammalian cellular basement membrane. While quality control measures are used to minimize the variability between production lots, lot-to-lot variations are inherent in any cell-derived product. Culture results may vary...
Equipment Specific equipment to study cardiomyocyte differentiation
A microelectrode array recording systems is available commercially from Multi Channel Systems MCS GmbH, Reutlingen, Germany http www.multichannelsystems.com . This system for in vitro applications includes a small amplifier for data acquisition, computer for recording and analysis, and can be accompanied by a programmable fluid perfusion temperature device. Specimen chambers with microelectrodes of various sizes arrayed at various distances and configurations are available from MCS as well as...
Differentiation of spinal motor neurons from hESCs
1. ESCs are differentiated to neuroepithelial cells in a six-well plate according to the procedure described in Chapter 14 for 10 days. 2. On day 10 of differentiation, primitive neuroepithelial cells characterized by their elongated, columnar morphology make up the majority of the inner cells in differentiating colonies Figure 15.1A,B . At this stage, aspirate off the medium and add 3 mL of fresh neural induction medium containing retinoic acid RA, 0.1 p M to each well of the six-well plate....
Polyornithinecoated coverslips Coverslip sterilization
1. Empty coverslips Bellco Catlog no. 1943-10012 into a pre-assigned beaker for nitric acid use. 2. Add approximately 50 mL nitric acid, or enough to cover the coverslips. Wear gloves and operate in a fume hood. 4. Pour out as much nitric acid from the beaker as possible without pouring out any coverslips. Rinse a few times with distilled water. 5. Leave beaker under running distilled water for at least 15 min. 6. Under a sterile hood, store coverslips in 95 ethanol. Two 50 mL centrifuge tubes...
Growth factors 1
Stem cell factor hSCF R amp D Systems 225-SC Flt-3 ligand hFlt-3 L R amp D Systems 308-FK Interleukin-3 hIL-3 R amp D Systems 203-IL Interleukin-6 hIL-6 R amp D Systems 206-IL Granulocyte colony-stimulating R amp D Systems 214-CS factor hG-CSF Erythropoietin hEPO Granulocyte monocyte colony-stimulating growth factor hGM-CSF Bovine pituitary extract hVEGF-A165 R amp D Systems R amp D Systems R amp D Systems
Setup for vitrification
Label 4.5 mL cryovials with cell line, passage number, and date. Puncture vials with an 18G needle through the top and on the side so that liquid nitrogen can fill the vial. Use a four-well plate with three wells containing 1 mL each of holding medium HM , VS1, VS2 vitrification solutions on a heating stage of a dissecting microscope Figure 4.2 . Transfer of the cells will be done in droplets of VS2 on the inside of the lid of the four-well dish. Figure 4.2 Four-well plate and lid set up for...
List of Contributors
Lars Ahrlund-Richter Dept of Laboratory Medicine Karolinska Institute 141 57 Stockholm, Sweden Zentrum f r Integrative Psychiatrie, Kiel Zellbiologisches Labor Niemannsweg 147 24105 Kiel, Germany Burnham Institute for Medical Research 10901 N. Torrey Pines Rd La Jolla, CA 92037, USA Shawn Baker Illumina, Inc. 9885 Towne Centre Drive San Diego, CA 92121, USA Burnham Institute for Medical Research 10901 N. Torrey Pines Rd La Jolla, CA 92037, USA David L. Barker Illumina, Inc. 9885 Towne Centre...
Freezing cells by open pulled straw vitrification
Open pulled straw OPS vitrification is not a trivial technique. It requires preparation of three different media and careful work under a dissecting scope. In this method, hESC colonies are dissected, and 10-12 individual undifferentiated pieces of colonies are carefully collected and placed into sequential vitrification media with increasing concentrations and combinations of cryoprotectants. The cells are then placed into straws and frozen by plunging into liquid nitrogen. In spite of the...
Laborato ry General considerations
hESC culture laboratories are similar to other cell culture research facilities. Space is required for tissue culture, standard biochemistry and molecular biology, and cell imaging. Incoming material and waste disposal logistics need to be accommodated. When setting up a laboratory, we typically define two distinct work areas a cell culture area with rooms that can be dedicated for different types of work Figure 26.1 and a molecular biology area with laboratory benches and appropriate...
Autogenic feeder cells
Stojkovic P, Lako M, Stewart R, Przyborski S, Armstrong L, Evans J, Murdoch A, Strachan T, Stojkovic M 2005a . An autogenic feeder cell system that efficiently supports growth of undifferentiated human embryonic stem cells. Stem Cells 23 306-314. Stojkovic P, Lako M, Przyborski S, Stewart R, Armstrong L, Evans J, Zhang X, Stojkovic M 2005b . Human serum matrix supports undifferentiated growth of human embryonic stem cells. Stem Cells 23 895-902. Xu C, Jiang J, Sottile V, McWhir J, Lebkowski J,...
Singlecolor analyses using flow cytometric analysis and cell sorting
Staining of hESCs with GCTM-2 or SSEA3 for flow cytometry 1. Carefully harvest hESCs using a non-enzymatic dissociation buffer Gibco, Sigma and dissociate into a single-cell suspension by trituration a Wash the cells twice with PBS and then incubate for 5 min with non-enzymatic dissociation buffer. Gently lift hESCs and triturate in the dissociation buffer using a 1 mL pipette tip. b Centrifuge gently 500X g for 2 min , remove supernatant and wash in a similar fashion 2X with PBS, 0.01 BSA wash...
Overview Illumina SNP genotyping assays
Illumina developed and commercialized two SNP genotyping assays. The GoldenGate assay Fan et al., 2003 Shen et al., 2005 multiplexes from 96 to 1536 SNPs determined on each sample, with data read out from hybridization of an assay mixture to a universal array. The Infinium assay uses a method of sample preparation that makes it possible to read out any number of SNPs from one sample, limited only by the number of elements present on the microarray. Illumina provides Infinium BeadChip arrays of...
What Effect are Stem Cell Patents Having on Innovation
Although many patent holders choose to license others to practice the patented invention in exchange for royalties, in the United States, licensing is not compulsory patent holders can choose to license on their own terms or not to license at all. Because WARF controls the rights to hESCs, researchers who wish to use these cells must be aware of their obligations to the patent owners under US law. The NIH took steps to engage WARF's cooperation, signing a memorandum of understanding MOU with...
Other references cited in the text
Diamond v. Chakrabarty, 447 U.S. 303, 1980. Federal Register Vol 66 1092-1099 January 5, 2001. The training materials can be found on the Internet at Harvard hESC material transfer agreement MTA www.mcb.harvard.edu melton hues HUES_request.html HR 810 The Stem Cell Research Enhancement Act of 2005. The NIH has a tracking site for information about health-related legislation Labosky PA, Barlow DP, Hogan BLM 1994 . Mouse embryonic germ EG cell lines their transmission through the germline and...
Culture medium supplement stock Human EGF 20pgmL 1000X 10mL
Human EGF 0.2 mg Reconstitute the contents of the vial using 10 mL of 0.2 pm-filtered 10 mM acetic acid containing 0.1 BSA.
Gene targeting in mESCs
The term gene targeting is commonly used to describe the introduction of virtually any kind of genetic change into a specific gene locus in the genome via the process of homologous recombination. It is the only method that allows for the generation of any desired mutation with single nucleotide accuracy. The importance of targeted mutagenesis of the mouse for contemporary drug discovery cannot be overstated 80 of the 100 currently most widely sold drugs act on only one human gene and each of...
Mercaptoethanol
2-Mercaptoethanol 2-ME has been used in ESC culture media since the first derivation of mouse ESCs in 1981. Originally included as a reducing agent because of concern about oxidation of culture components, it continues to be used in hESC media. Since the final concentration is 0.1 mM, and the pure solutions of 2-ME are 14.3 M, it is necessary to start with a stock solution. Several companies sell diluted solutions of 2-ME the 55 mM solution in PBS Invitrogen catalog no. 21985-023 is a...
Dispersal of cardiomyocytes for flow cytometry or clonogenic assays
EBs are prepared from hESCs as above. Identification of cardiomyocytes is readily apparent if labeled by eGFP expression from a myocardial promoter such as MYH6 aMHC. Differentiation is allowed to proceed for 9 days. 1 Isolate beating areas by microdissection in a cell culture hood. Collect the foci of beating cells in 1.5 mL Eppendorf tubes containing differentiation medium. 2 Wash dissected beating areas twice with PBS. 3 Incubate for 5 min at 37 C with 0.25 trypsin EDTA. 4 Add 1 volume of...
Culture medium supplement stock Transferrin human 1000X 2 mL
Transferrin 10 mg To prepare a 50mg mL stock solution add 2mL sterile tissue culture medium. Gently swirl to dissolve.
Culture medium supplement stock Retinoic acid 2000X 83 mL
Retinoic acid 50 mg RA is supplied in sealed vials. This recipe is for a vial containing 50 mg of powder. Add 1 mL of DMSO to the vial and swirl to dissolve. Transfer the solution to a 15 mL tube and wash the ampoule with 200 pL of DMSO. Add DMSO to a final volume of 8.3 mL. Make 100-300 pL aliquots of this mixture in light protected vials and store at 80 C.
ESC medium 500 mL
MEM non-essential amino acids solution Sterile filter with a 0.22 pm filter, add 4ng mL bFGF just prior to feeding cells. Medium is stored at 4 C for up to two weeks.
Fertilization check
Fertilization check is done approximately 15-17 h after insemination sperm-egg interaction . By this time, the majority of the cumulus mass has dispersed from the cumu- lus-oocyte complex and the presence or absence of motile sperm can be recorded. 1. Retrieve the patient's organ culture dish from the incubator and place on the heated stage of the dissecting microscope in the laminar flow hood. 2. Using an orally controlled, finely drawn sterile Pasteur pipette fitted with a 0.22 pm Millipore...
Oocyte insemination
1. Inseminate the oocytes approximately 3-5 h post-retrieval. 2. Each oocyte is inseminated with 5 X 103 motile sperm. The volume of sperm added to each oocyte is dependent on the concentration. For example, if the Figure 24.2 Oocyte insemination via intracytoplasmic sperm injection. Figure 24.2 Oocyte insemination via intracytoplasmic sperm injection. patient has a concentration of 45 X 106 motile sperm mL, each drop will be inseminated with approximately 1.1 pL of the prepared sperm sample....
Procedures Antibodies for detection of undifferentiated hESCs
Antibodies reactive with human embryonic stem cells hESCs are important tools that enable the identification, isolation and characterization of specific cell types whether differentiated or undifferentiated. Markers originally developed for human embryonal carcininoma EC cell lines also recognize hESCs, and other markers have been added in the last several years Table 8.1 . Antibodies that detect epitopes expressed on the surface of hESCs allow the characterization and comparison of different...
Transduction of hESCs with lentivirus
It is essential to estimate the final titer for calculating the ideal MOI number of viral particles per unit recipient cells . Statistical methods suggest that if all cells in a population are equally likely to be infected, and if 20 or fewer cells actually get infected then the probability of multiple insertions in each of the cells is very low. However the MOI required to achieve 20 infection in different cell types varies enormously. For example, for mouse embryonic fibroblasts MEFs this can...
Culture medium supplement stocks
Supplier Catalog no. Stock concentration Putrescine Sodium selenite Transferrin human T3 triiodotyronine triiodo-1-thyrosine Insulin, bovine Retinoic acid - Sigma P-6024-1MG Sigma S9133-1MG Sigma 8158-100MG Sigma T67407-100MG Sigma I1882-100MG Sigma R2625-50MG Sigma E9644-0.2MG Invitrogen 17504-044 100 pg mL 50 pg mL 50 mg mL 40 pg mL 0.1 pg mL 50 ng mL 50 pg mL 40 ng mL
Matrigel coating
Note Matrigel must be kept cold until ready for use because it gels instantly when it warms to room temperature. Manipulations after thawing have to be done quickly on ice. If it gels prematurely, Matrigel may be re-liquefied on ice at 2-8 C for 24-48 h. 1. Place the bottle in an ice-cold water bath and before completely thawing, open the cap and add 10 mL knockout D-MEM. 2. Dissolve the remaining frozen block by pipetting up and down avoid foaming and quickly aliquot 2mL of 1 2 Matrigel into...
Immunosurgery
The microdissection technique described to isolate the ICM from the blastocyst can be substituted with an immunosurgery technique modified from a procedure developed for derivation of mouse ESCs. Briefly, after hatching, the blastocysts are incubated with an anti-human cell surface antibody that binds to the external layer, the trophoblast. After rinsing away excess antibody the embryos are treated with guinea-pig complement. The complement-antibody binding initiates lysis of the trophoblast....
Enzymatic dissociation
Enzymatic dissociation methods vary widely, and the exact conditions need to be developed for each laboratory. Most importantly, cultures that have been maintained by manual passaging cannot be passaged by enzymatic dissociation unless exceptional care is taken to adapt and monitor the cells. The type of enzyme used for dissociation is critical. For example, passaging with trypsin appears to put more selective pressure on the cultures than other methods, resulting in a higher incidence of drift...
Striatal stem cell transplantation rat
Parkinson's disease is a common neurological disorder characterized by a dopamin-ergic deficit in the striatum, principally caused by the degeneration of the substantia nigra. This relatively focal pathology offers the option to treat the disorder with cell replacement therapy. Since the 1980s preclinical and clinical experiments with transplantation of fetal mesencephalic progenitor cells gathered evidence for possible efficacy. However, the use of grafts derived from fetal sources remains...
Supplies and Reagents Supplies
Axon Instruments Molecular Devices Axon Instruments Molecular Devices Axon Instruments Molecular Devices
Virus harvesting medium without serum 500 mL
Ultraculture medium Bio-Whittaker catalog no. 12-725F L-Glutamine 100 X Pen-strep 100 X 293T culture medium virus harvesting medium with serum 500 mL D-MEM high glucose Sodium pyruvate 100 X L-Glutamine 100 X Pen-strep 100 X Fetal bovine serum Invitrogen Adjust pH to 7.0-7.2 with 10 N NaOH, Make up volume to 500 mL. Filter through a 0.22 pm filter. Aliquot and freeze. Adjust pH to 7.0-7.2 with 5 N NaOH, Make up volume to 500 mL. Filter through a 0.22 pm filter. Aliquot and freeze.
Genetically modified hESCs MYH6aMHCGFP MYH6aMHCPuro
A simple approach for generation of pure cultures of cardiomyocytes from differentiating hESCs is to genetically engineer the cells to allow selection for the cells that express cardiac-specific markers. We created a derivative of the WA09 hESC line that expresses two selectable markers under control of the MYH6 aMHC promoter enhanced green fluorescent protein eGFP and a puromycin resistance gene. We generated this cell line by a two-step process. Note See Chapter 19 for methods for infection...
Culture medium supplement stock T3 triiodotyronine 1000X 100mL
T3 triiodothyronine triiodo-1-thyronine 100 mg To prepare a 40 pg mL stock add 1 mL 1N NaOH to dissolve to 100 mg mL and then dilute 40 pL into 100 mL D-MEM to 40 pg mL .
Day 0 Formation of embryoid bodies
1. Aspirate the medium from each well. 2. Add 0.5 mL of pre-warmed collagenase IV 200 units mL solution per well. 3. Incubate at 37 C for 5-10 min. 4. Aspirate the collagenase IV. Figure 18.1 Schema of hematopoietic differentiation protocol from hESC-derived embryoid bodies. Figure 18.1 Schema of hematopoietic differentiation protocol from hESC-derived embryoid bodies. 5. Wash with 2 mL of pre-warmed knockout D-MEM per well and aspirate. 6. Add 2 mL of warm EB medium 80 knockout D-MEM, 20 FBS...
Embryoid body formation Maintenance of hESC cultures
Undifferentiated MYH6 aMHC-GFP MYH6 aMHC-Puro hESC passage gt 50 is expanded by co-culture with MEFs plated on Matrigel matrix in hESC maintenance medium. Medium is changed daily and cells are split 1 3 once a week. Removal of MEFs hESCs must be completely free of MEFs in order to form differentiation-competent EBs. Figure 17.1 hESC-derived cardiomyocytes. A Upper HIV lentiviral based construct provides eGFP to visualize cardiomyocytes whereas lower construct allows blasticidin resistance...
Collagenase IV 200 unitsmL 100 mL
Component Amount Stock concentration Collagenase IV Invitrogen 20 000 units typically 200 U mL in D-MEM Catalog no. 17104-019 1 mg mL Dissolve 20 000 units of collagenase IV in 100 mL of D-MEM usually 1 mg mL . Filter using a 250 mL filter unit. Aliquot in 5-10 mL tubes and store at 20 C until use. Collagenase is isolated from Clostridium histolyticum. Type IV is selected because of low tryptic activity and is recommended for isolation of pancreatic islets. This is a crude product, so expect...
Production of lentivirus transient transfection protocol
Viral stocks pseudotyped with the vesicular stomatitis virus G protein VSV-G are prepared by transient co-transfection of 293T cells using a three-plasmid system the transfer vector the pCMVA R8.74 encoding Gag, Pol, Tat, and Rev and the pMD.G plasmid encoding VSV-G . Infectious lentivirus is harvested at 48 and 72 h post transfection and filtered through 0.22 pm-pore cellulose acetate filters. The lentiviruses can be concentrated either by ultracentrifugation 2h at 68 000 Xg in SW28 rotor or...
Reading List Lqg
The following list of books and papers is a selective compilation for investigators not currently using the lentiviral system. Katkov II, Kim MS, Bajpai R, Altman YS, Mercola M, Loring JF, Terskikh AV, Snyder EY, Levine F 2006 . Cryopreservation by slow cooling with DMSO diminished production of Oct-4 pluripotency marker in human embryonic stem cells. Cryobiology 53 194-205. The authors describe a clone of hESC that expresses GFP under the tissue specific POU5F1 OCT4 promoter. Liu YP, Dovzhenko...
Nonenzymatic cell dissociation
Ca2 - and Mg2 -free saline solutions containing EDTA or EGTA have not been as widely used for hESC dissociation as the methods described above, but they should offer advantages for assays that require intact cell surface proteins such as flow cytometry and immunocytochemistry. Commercial formulations are available, such as Cell Dissociation Buffer Invitrogen catalog no. 13150016 , which contains glycerol as well as a proprietary mixture of salts and chelators. If you decide to try this method,...
Monitoring for mycoplasma contamination
Mycoplasma are the smallest forms of bacteria 0.2-0.3 m in diameter and they can pass through the typical microbiology 0.2 m filter used in cell culture and do not produce the characteristic turbid growth shown by other bacteria. Because they lack cell walls, they are unaffected by the standard antibiotics used in culture media penicillin and streptomycin that act on bacterial cell walls . Serious infections can be detected in cultures by DAPI or Hoescht staining for DNA stained cell nuclei...
ndix 101 Primers for RTPCR
Gene-specific forward and reverse primers can be designed using freely available web-based software Primer3, Netprimer, Beacon Designer, mFold and Oligonucleotide Properties Calculator, e.g. and their specificity can be analyzed by alignment to the GenBank sequence http www. ncbi.nlm.nih.gov BLAST . CACCCTGAAGTACCCCATCGAGCA CAGGTCTTTGCGGATGTCCACGTCAC TGGCACCACACCTTCTACAATGAGC GCACAGCTTCTCCTTAATGTCACGC TGACGGGGTCACCCACACTGTGCCCATCTA CTAGAAGCATTGCGGTGGACGATGGAGGG ATTGTGACCACCACGAGAGTGAAC...
Antibodies for immunocytochemistry
polyclonal MAP2 Ms IgG1 NeuN Ms IgG1, Ms IgG1 GFAP Ms IgG1 S-100 Ms IgG1 Myelin proteolipid protein Ms IgG2a Becton-Dickenson N17220-050 Covance Research PRB-435P Products, Inc. Ms IgG1 Chemicon AB5622 Rb Abcamab13938 Ms IgG1, clone 4G2 Chemicon AB1981 Rb Santa Cruz sc-7170 Goat Swant 37 Rb Calbiochem NB38 Ms IgG2a, clone plpc 1 Continued Item Supplier Catalog no. Alternative Item Supplier Catalog no. Alternative