PCR of dCTailed cDNA 1
The first and following nested see Subheading 3.5. PCR amplifications must be set up with the tubes in wet ice to avoid non-specific extension of the primers. The cycling protocol and annealing extension temperatures used in this protocol correspond to those used in the TFG 5'RACE 7 , but these conditions must be optimized for RACE extensions of other genes. 1. Equilibrate the thermal cycler to 94 C. 2. Label the thin-wall PCR tubes sitting on ice with appropriate nomenclature. 3. Add the...
Heteroduplex Analysis 1
1. Ensure that the glass plates are scrupulously clean before starting by cleaning with absolute alcohol and then rinsing in deionized water. 2. For a 6 gel, add 8.58 mL of deionized water, 12.5 mL of TBE, 3.72 mL of Accugel mix 29 1 and, finally, 150 pL of 20 AMP and 22.5 pL of TEMED see Note 21 . 3. Using a 20-mL syringe, transfer the gel mix between the two plates, insert the comb, and leave to stand for 30 min. 3.4.2. Sample Preparation and Gel Electrophoresis 1. Remove the comb from the...
Immunoprecipitation Technique
A combination of immunoprecipitation and Western blotting techniques enables the functional status of ALK and the identity of interacting proteins to be studied 23,27 . 3.5.1. Immunoprecipitation Followed by Western Blotting 1. Prepare Protein G GammaBind Plus Sepharose pre-bound to antibody as follows a. Wash Protein G GammaBind Plus Sepharose three times in PBS. b. Add 2 mL of purified antibody in 1.25 mL PBS or 1.25 mL monoclonal antibody supernatant to 0.5 mL 10 vol vol Protein G GammaBind....
Mariella Dono and Manlio Ferrarini
Marginal zone MZ or MZ-like B-cells home outside the follicles of peripheral lymphoid tissues. Prototypic examples of these B-cells are those that home the MZ of the spleen, although B-cells with similar phenotypic and functional features can be found in the subepithelial SE areas of tonsil, in the Peyer's patches, in the lymph nodes, and in the thymic medulla. MZ-like B-cells also develop in mucosa-associated lymphoid tissue MALT and other sites salivary glands, thyroid that acquire organized...
Future Developments
The antibodies described above allow B-cell lymphomas to be crudely divided into two groups those with a germinal center phenotype and the remainder that are mainly postgerminal center tumors. As has been shown, this simple division has both prognostic significance and correlates with the presence of specific balanced translocations involving bcl-2 and c-myc. However, as knowledge of the normal biology of the germinal center develops, it will become possible to use immunophenotypic methods to...
All incubation and wash steps should be conducted with gentle shaking
1. Block membrane by incubating with the appropriate blocking buffer i.e., TBS or TBST, see Table 1 for 1 h at room temperature. 2. Discard blocking buffer and incubate membranes overnight at 4 C with primary antibody in the appropriate blocking buffer see Note 12 . 3. Wash membrane three times for 5 min in TBS TBST. 4. Incubate membrane for 1 h at room temperature with the appropriate secondary antibody in the appropriate blocking buffer. 5. Wash membrane three times for 5 min in TBS TBST. 6....
Double Immunolabeling Procedures
This technique can be used to study the expression of two proteins present in different cell populations on the same section or when the relevant proteins are present in different subcellular compartments, for example, the nucleus and the cytoplasm 22 . 1. It is recommended that the antigen present in the smallest amount should be visualized first using an immunoperoxidase labeling technique see Note 19 . 2. The counterstain step should be omitted. 3. Perform the APAAP labeling technique as...
Analysis of TCR PCR Products
Clonal products with identical junctional regions homoduplexes are visualized as sharp narrow bands within the appropriate size range whereas polyclonal products are seen as ill defined smears heteroduplexes retarded at higher molecular weight due to conformational differences of duplexes of less perfectly matched junctional regions. Clonal products are seen as narrow peaks because of identically sized products, whereas polyclonal products give a gaussian distribution of the differently sized...
BCL6 and Cytogenetics
Chromosomal translocations produce their effects in malignant disease essentially by one of two mechanisms. First, a fusion gene can be produced that commonly has a modular structure, for example, a DNA binding domain from one gene is joined to an effector domain from a different gene or, second, translocation can cause overexpression of a gene whose effects are to enhance cell growth or prevent apoptosis. It is surprising that fusion genes are found predominantly in myeloid malignancies,...
Analysis of Tumor Clonality
PCR DNA from amplified tumor V genes can be cloned using basic, standard procedures to examine clonal variation in tumor-derived V gene sequences. Because tumor cells represent a specific, clonal expansion of B-cells, it follows that the predominant cDNA species in the oligo dT primed pool is derived from tumor cells. By cloning PCR DNA and analyzing multiple colonies, the predominant sequence is readily identified by a common CDR3 sequence and represents the tumor V gene. This is now an...
Immunocytochemistry Methods
Lymph nodes should then be cut along the longitudinal axis into 1- to 2-mm slices see Note 5 . Fix representative slices for 24-48 h at room temperature and process to paraffin wax. The remainder of the tissue is used for flow cytometry and molecular studies as required. One of the most important advances in immunocytochemistry in recent years has been the development of techniques designed to unmask antigen sites that have been obscured by tissue fixation. Traditionally, this was achieved by...
Preface Germinal
The molecular investigation of hematological malignancies has always forerun that of other cancers. There are a number of potential reasons for this, some of which are more logistical than theoretical, and include the ready access to pathologic material with the presence of malignant cells generally in great excess in comparison with the normal. These factors are combined with a set of diseases for which potentially curative systemic therapies are available, making the precise subclassification...
PCR Amplifciation of Intron 1 of BCL6
Primers A 5' CCGCTGCTCATGATCATTATTT 3' and B 5' TAGACA CGATACTTCATCTCAT 3', as in 59 amplify a PCR fragment 791 bp in length containing intron 1 of the BCL6 using 1.5 mM MgCl2. 5. Repeat steps 2 to 4 for 30 to 40 times as necessary for specific application. 4. Notes 1. Template preparation PCR may fail if the template is degraded. The latter can arise if DNA was extracted from paraffin-embedded tissue, particularly with some fixatives used in preparation of biopsies. Degraded template can be...
Homogenization
1. Place lymph node in 10 mL of preparation medium. 2. Place sterile sieve in a 10-cm Petri dish and add lymph node and medium to sieve. 3. Hold lymph node with forceps and cut into small pieces with scissors. 4. Use the plunger from a 20-mL syringe to gently force the sample through the sieve in to the Petri dish. 5. Add 5 mL of preparation medium and wash any remaining cells through sieve. 6. Transfer cell suspension from the Petri dish to 50-mL Falcon tube see Note 6 .
Introduction Axh
Anaplastic large cell lymphoma ALCL expressing anaplastic lymphoma kinase ALK also referred to as ALK-positive ALCL or ALKoma is a distinct clinicopathological and molecular entity characterized by a proliferation of T null lymphoid cells that show a diverse immunostaining pattern for ALK protein 1-3 . This aberrant ALK expression is associated with chromosomal translocations involving the ALK gene at 2p23 4 . These translocations lead to the synthesis of novel chimeric proteins that retain the...
X concentration 200 ml MES 2 M NaCl 40 mM EDTA and 002 Tween20
1. 12X MES stock see Subheadings 2.13.1. and 2.13.2. . 2. Analytical-grade water e.g., from a bench-top unit such as Simplicity Personal Ultrapure Water System, Millipore cat. no. SIMS 600 00 . 3. 5 M sodium chloride Sigma-Aldrich cat. no. S-S150 . Store at RT, stable for 1 yr. 4. EDTA di-Sodium Salt, pH 8.0 Sigma-Aldrich cat. no. E-7889 . Store at RT, stable for 1 yr. 5. Tween-20 Sigma-Aldrich cat. no. P-9416 . Store at RT, stable for minimum 1 yr.
Kim Last Silvana Debarnardi and T Andrew Lister Summary
This chapter describes the illness diffuse large B-cell lymphoma DLBCL and why research has and continues to focus on creating accurate predictors of response to treatment to allow individual risk assessment for a patient and individualization of treatment choice to maximize the chances of cure. Microarray technology has the promise to bring these objectives within reach. The first papers attempting to identify molecular signatures of response and outcome using microarray technology were...
Andrew Jack Sharon Barrans David Blythe and Andrew Rawstron Summary
The germinal center plays an important role in the pathogenesis of B-cell lymphomas, and evidence exists to suggest that most cases are germinal center or postgerminal center derived. Burkitt lymphoma and follicular lymphoma are derived from the germinal center stage of differentiation. It has been shown that diffuse large B-cell lymphomas with a germinal center-type pattern of RNA expression or a germinal center cell phenotype using immunocytochemistry have a more favorable outcome compared...
GlassMax DNA Isolation Spin Cartridge Purification of cDNA
In addition to the reactives here described, a tabletop microcentrifuge, wet ice, 1.6-mL polypropylene Eppendorf tubes, and a thermal bath equilibrated at 65 C also are needed. 2. GlassMAX spin cartridges also included in the kit . 3. 1X Wash buffer. Before using the system for the first time, the wash buffer must be prepared from the buffer concentrate supplied in the kit Pipet 1 mL of the concentrate into a 50-mL Falcon tube, and then add 18 mL of deionized water and 21 mL of absolute...
Concentration and Cleaning of Total RNA by Ethanol Precipitation
1. Isopropanol BD cat. no. 10224 . Store at room temperature stable for minimum 5 yr. Safety information highly flammable. Keep away from sources of ignition. Keep container tightly closed. May cause harm to the unborn child. Irritating to eyes. 2. 3 M sodium acetate, pH 5.2 Sigma-Aldrich cat. no. 57899 . Store at RT stable for 1 yr. Safety information avoid contact and inhalation. 3. 100 ethanol BD cat. no. 10107 . Store at RT stable for minimum 5 yr. Safety information highly flammable. Keep...
Isolation of MZ BCells From Tonsils
In situ studies demonstrated that B-cells in the SE or in the intraepithelial areas of human tonsils displayed a phenotype different from that of B-cells from the GC and FM of the follicles 8,9 . For example, SE B-cells express low levels of CD21, CD38, and CD23, which are found on FM CD23 and GC CD38, CD21 B-cells. SE B-cells also are composed of some CD39 or CD69 cells, indicating the presence of activated cells 8 . In addition, anti-IgD antibodies stained a fraction of SE B-cells, whereas FM...
Introduction Tdr
The recognition of diverse antigens is critical to the humoral response and is mediated by the immunoglobulin Ig molecule expressed by B-cells. Specificity for antigen is determined by the variable V regions in the heavy VH and light VL chains, encoded by the corresponding V genes. Remarkably, affinity for antigen can be increased by the process of somatic mutation 1 . This process is activated after an encounter with the antigen in the T-cell-rich zones of secondary lymphoid organs and...
PCR Detection of Antigen Receptor Gene Rearrangements
Although most follicular lymphomas exhibit t 14 18 and other lymphomas have characteristic chromosomal translocations, for patients with follicular lymphoma who do have a PCR amplifiable t 14 18 , alternative strategies must be developed to detect MRD. Follicular lymphomas rearrange their Ig genes, providing a clonal marker that also can be amplified by PCR. The most Fig. 1. The bcl-2 IgH rearrangement results from the translocation of the bcl-2 proto-oncogene from chromosome 18 to the IgH...
Making Slides for FISH
From Fixed Cell Suspension of a Single Patient 1. Remove stored fixed cell suspension from the freezer. 2. If necessary, transfer to a centrifuge tube suitable for assessing the turbidity of the suspension. 4. Remove the supernatant and resuspend the pellet in a suitable quantity of fresh fix. 5. Drop a single drop of the suspension on to a slide and allow to air dry such that the appearance under phase contrast is as grey as possible see Note 13 . 6. When dry, run five or six further drops of...
Flow Cytometry Methods
Flow cytometry is the method of choice for identifying germinal center B-cell lymphomas in which unfixed tissue specimens are available or for the detection of these tumors in the bone marrow, peripheral blood, or serous effusion specimens. As with immunocytochemistry, the quality of the specimen and its initial handling are crucial to obtaining satisfactory results. Tissue specimens must be fresh and ideally should be sent to the laboratory by the fastest route after being removed from the...
Introduction Uuq
Recent data to from humans have indicated that mature B-cells are heterogeneous and display characteristic phenotype, morphology, and functions depending upon the site of homing in the peripheral lymphoid tissues 1 . In secondary lymphoid organs, B-cells are organized in defined structures, the secondary follicles. However, there also are B-cells that home outside the follicle and are generally referred to as extrafollicular B-cells or other names, depending upon the different lymphoid organs...
Interpretation of TCR Data
Data should always be interpreted in the context of complete clinical, histo-logical and phenotypical data. Furthermore, known positive, and polyclonal, and negative controls should always be set up for each multiplex TCR PCR tube. The optimal assessment of TCRG gene rearrangements requires both heteroduplex and genescanning analysis. Heteroduplex alone may be associated with false-negative results because of sensitivity issues whereas genescanning alone will increase the risk of false-positive...
An Introduction to Microarray Technology
The means of discovery of molecular signatures of response, long-term outcome, and subtype definition took a great leap forward with the advent of microarray technology 7,8 . By allowing the simultaneous measurement of the mRNA expression of 100s to 1000s of genes from across the genome, array technology offered the potential to screen thousands of genes without the need for preconceived hypotheses. Microarrays can investigate mitochondrial RNA mRNA or genomic deoxyribonucleic acid DNA ....
Preventing RNA Degradation and Contamination
RNA degradation is one of the principal problems and frustrations of gene expression profiling. To prevent RNase contamination, always wear latex or vinyl gloves and use diethyl pyrocarbonate DEPC -treated distilled water see below , sterile RNase-free disposable pipet tips, and Microfuge tubes throughout the procedure. Avoid sources of dust or other contaminants, which can interfere with the multiple procedures you will be undertaking. 1. 2-, 20-, 200-, and 1000- L pipets. 2. RNAse-free tips...
Sample Purification 1
1. Carefully overlay 20 mL blood onto 20 mL histopaque and spin in an un-braked centrifuge for 30 min at 400g. 2. Remove the lymphocytes which form a layer at the interphase between the histopaque and the plasma using a plastic Pasteur pipet and transfer to a clean tube. 3. Remove the granulocytes which form a layer on top of the red blood cell pellet underneath the histopaque at the base of the tube using a plastic Pasteur pipet and transfer to a clean tube. 4. Wash the lymphocytes with 30 mL...
Single Immunolabeling Procedures
1. Staining tray and trough Raymond Lamb, London, UK . 2. Monoclonal antibodies and rabbit polyclonal primary antibodies see Table 2 . Primary Antibodies for Use in Immunolabeling and Biochemical Studies of ALK-Positive ALCL Primary Antibodies for Use in Immunolabeling and Biochemical Studies of ALK-Positive ALCL Suitable for IHC, immunohistochemistry CS, cryostat sections PS, routinely fixed sections immunofluorescence studies WB, Western blotting IP, immunoprecipitation studies. Suitable for...
TE Equilibrated Phenol
DNA is soluble in acidic water-saturated phenol and so it is necessary to equilibrate it to a neutral pH. 1. Take 500 mL of water-saturated phenol. Prepare 500 mL of 0.5 M Tris, pH 8.5, add 150 mL of this to the phenol, and mix by inversion for 2-3 min. Leave to stand until the aqueous and organic phases have separated. 2. Remove and discard the upper aqueous layer. Add another 125 mL of 0.5 M Tris, mix, let stand, and remove the aqueous layer as before and then repeat. 3. To the remaining 100...
Cell Storage and Freezing 1
Diagnostic lymph node biopsies are received fresh on the day of surgery and processed on the same day. An aliquot of cells is used for immunophenotyping by fluorescence-activated cell sorting analysis for IgM, IgD, IgG, and IgA and kappa and lambda expression. 1. Using a sterile scalpel, lymph nodes are cut into small pieces and the cells dispersed by forcing through a fine sieve e.g., a sterile metal tea strainer into sterile RPMI medium. 2. Cells are collected, centrifuged, and washed once in...
Heteroduplex Analysis
Heteroduplex analysis is used to discriminate between heterogeneous and homogeneous PCR products. Clonal PCR products will anneal to form homoduplexes after heat denaturation and rapid cooling whereas polyclonal PCR products will form heteroduplexes. The homoduplexes can be separated from the heteroduplexes on a nondenaturing polyacrylamide gel as they migrate more rapidly through the gel whereas the heteroduplexes from a background smear of slower-migrating species. In addition to the...
Introduction 1
Chromosomal analysis of non-Hodgkin's lymphoma NHL has clearly identified that several subtypes of lymphoma are associated with specific cytogenetic rearrangements 1 . In most of these abnormalities, the chromosomal breakpoints are widely scattered such that molecular analysis is not guaranteed to detect the rearrangement. Cytogenetic analysis of lymph node material is extremely effective with an expected abnormality rate of approx 90 . In contrast cytogenetic analysis of bone marrow and blood...
Preparation of Purified Suspension of BCell Subpopulations
The isolation and purification of B-cell subsets from tonsils include ordered steps that usually can be performed in 2 d of work. The amount and purity of the isolated B-cells obtained from each experiment varies greatly among tonsils. 3.1.1. Handling of Tonsillar Specimens Surgically removed tonsils from 5- to 12-yr-old children are stored quickly in a tube containing physiological saline that is kept at 4 C. Before processing, tonsils usually are treated rapidly with 100 ethanol approx 30 s...
Multiplex PCR Amplification of TCRB TCRG TCRD and Control Genes 1
3.3.1. PCR Amplification of TCRG Chain Genes 1. Two multiplex PCR tubes are used to analyze different VJ recombinations of the TCRG chain genes. Both tube A and tube B are set up similarly with the same J primers but different V primers Fig. 2 . The J1.3 2.3 primer is labeled with FAM, and the J1.1 2.1 is labeled with HEX see Note 7 . The tubes see Note 8 are set up in a total reaction volume of 50 L as follows Sterile water see Note 9 10X buffer II dNTP mix 1.25 mM MgCl2 25 mM TCRG primers...
A TimeScale From Tumor to Chip to Data Analysis
RNA extraction, clean-up, and assessment, 3 h Day 1 First-strand cDNA synthesis, 2 h Day 2 Second-strand cDNA synthesis, 2 h Day 2 Clean-up and assessment of biotinylated cRNA, 1 h Fragmentation and assessment of biotinylated cRNA, 2 h Hybridization onto chips, overnight 16 h Fluidics 1st SAPE, antibody, and 2nd SAPE staining, 2 h Good-quality RNA is essential to the overall success of the analysis. We strongly recommend that you work on as few as two samples at a time and no more than eight to...
TdT Tailing of cDNA
TdT tailing creates the bridged anchor primer binding site on the 3'-end of the cDNA. 1. Add the following components to each tube and mix gently GlassMAX purified cDNA sample 10 L 2. Incubate for 3 min at 94 C. Chill 1 min on ice. Collect the contents of the tube by brief centrifugation and place on ice. 3. Add 1 L of TdT see Note 8 , mix gently, and incubate for 10 min at 37 C. 4. Heat inactivate the TdT for 10 min at 65 C. Collect the contents of the reaction by brief centrifugation and...
The SEREX Technique
The original SEREX technique relied on the detection of antigens expressed by a tumor-derived cDNA library screened with autologous serum i.e., derived from the same patient as the tumor 15 . Subsequently, a number of variations of this technique have been developed and these are discussed where appropriate. There is a SEREX database http www.licr.org SEREX.html that is maintained by the SEREX core group. This site provides information on sequences obtained using SEREX and links to other...
The precipitation is undertaken to concentrate the cleaned dscDNA ready for
1. Chill tubes of 80 and 100 ethanol to -20 C. 2. Precipitate each cleaned ds-cDNA sample, with the following reagents 2.5X volumes 100 cold ethanol 375 L 0.5X volume of 7.5 M ammonium acetate 75 L 3. Mix by tapping tubes or vortex briefly. 4. Centrifuge immediately at RT and maximum speed for 20 min. 5. A pellet of precipitated ds-cDNA will have formed at the bottom of the tubes. Keeping samples on ice, carefully remove the supernatant. 6. Wash the ds-cDNA pellet from salts by adding 500 L of...
Amanda P Liggins Barbara A Guinn and Alison H Banham Summary
Serological analysis of recombinant complementary deoxyribonucleic acid cDNA expression libraries SEREX is a powerful approach to identify immunogenic cancer-associated proteins using antibodies that are naturally present in the serum of cancer patients. This technique involves the screening of a relevant cDNA expression library with patient serum that has been cleaned to remove any antibodies that may recognize bacterial and or viral proteins. Once antigens have been identified and their...
GlassMAX DNA Isolation Spin Cartridge Purification of cDNA 1
This step is needed to remove the excess of nucleotides and GSP1 from the first strand product. In presence of a chaotropic agent sodium iodide , cDNAs with a minimal length of 200 bases are bound to the silica-based membrane. Buffer components, dNTPs, enzymes, and oligonucleotides remain in solution and are removed by centrifugation. Residual impurities and sodium iodide are removed by passing several volumes of 1X wash buffer followed by a 70 through the GlassMAX cartridge. Purified cDNA is...
Sequencing
BigDye Terminator v1.1 Cycle Sequencing Kit and ABI 377 automatic DNA sequencer Applied Biosystems, Warrington, UK . The sequencing reac tion is performed using a thermocycler with the corresponding thin-walled polypropylene tubes. 1. BigDye Terminator Ready Reaction Mix A-dye terminator labeled with dichloro R6G , C-dye terminator labeled with dichloro R0X , G-dye terminator labeled with dichloro R110 , T-dye terminator labeled with dichloro TAMRA , dNTP dATP, dCTP, dITP, dUTP , and AmpliTaq...
Rearrangement and Mutation in Lymphoma Simon D Wagner and Jaspal S Kaeda
BCL-6 is a zinc finger transcription factor that is highly expressed in normal germinal center B-cells. Its function is to prevent differentiation and apoptosis and allow growth. BCL-6 also is expressed in various lymphoproliferative conditions, for example, diffuse large cell lymphoma, Burkitt's lymphoma, and follicular lymphoma as well as lymphocyte predominant Hodgkin's disease. Expression also has been demonstrated in some T-cell lymphomas. In diffuse large cell lymphoma, BCL-6 is involved...
Assessing the Quantity and Quality of the Purified cRNA
3.7.1. Assessing the Quantity of the Purified cRNA by Spectrophotometry 1. Turn on the absorbance spectrophotometer 15 min before use. 2. Calibrate the meter using a DEPC H2O control according to the machine's specific instructions. 3. Quantify RNA yield by spectrophotometric analysis at 260 and 280 nm for sample concentration and purity. 4. Dilute 1 L of the cleaned cRNA in 4-9 L of DEPC H2O 1 5 to 1 10 dilutions 5. Measure the RNA concentration of each diluted cRNA. 6. Calculate the cRNA...
Assessing the Quality of Total RNA by Gel Electrophoresis
1. Agarose Invitrogen cat. no. 15510-027 Store in a cool and dry place at RT stable for minimum 5 yr. 2. Heating block suitable for 0.5-mL tubes. 7. Denaturing loading buffer see Subheadings 2.4.2.1. and 2.4.2.2. . 8. DNA ladder marker 200 base pairs bp to 3 kbp X174 DNA HaeIII Promega cat. no. G1761 store at -20 C stable for 1 yr and 1-kb DNA ladder Promega cat. no. G5711 store at -20 C, stable for 1 yr . 9. Ethidium Bromide tablets Sigma-Aldrich cat. no. E-2515 Store at RT stable for minimum...
Structure of IgH Locus and Its Recombinations
To understand the basis for the IGH LDI-PCR method, it is necessary to understand something of the structure of the IGH locus and its normal recombination events. The IGH locus comprises 51 functional variable VH segments, 27 diverse DH segments, 6 joining JH segments, and 9 constant CH segments Fig. 1 . Each CH segment except C5 is preceded by repetitive DNA sequences or switch S segments, which play a role in isotype class switch recombination. To generate IG diversity, two major somatic gene...
Katy McCann Surinder S Sahota Freda K Stevenson and Christian H Ottensmeier
Beyond the morphological, immunophenotypic, and genetic information used for the diagnosis of lymphoid malignancies, molecular analyses have deepened our insights into the development of B-cell lymphomas. We have learned that B-cell tumors can be grouped according to the mutational status of their immunoglobulin variable V region genes, and this has become an important prognostic tool in chronic lymphocytic leukemia. The analysis of V genes also has allowed us to more precisely place B-cell...
Isolation of Mononuclear Cells
1. Take the cell suspension from step 6 in Subheading 3.1.1. and underlay with 35 mL of Ficoll-Paque by placing the pipette tip at the bottom of the tube and gently releasing the contents so the cell suspension remains above the Ficoll-Paque. 2. Centrifuge at 500g for 25 min at room temperature. Use slowest acceleration and deceleration options if available. 3. A white cloudy interface will form, which contains viable mononuclear cells. Above this will be a layer of media and below the...











