Notes Qqj
1. Instead of the CD34 Isolation kit, the AC133 Isolation kit Miltenyi Biotech can be used for the purification of hemopoietic progenitors. Also, instead of IMDM supplemented with insulin, transferring, and selenium, other liquid media, such as Stem Span Stem Cell Technologies can be used. There is no reason to use FCS for the expansion of hemopoietic stem cells. However, the addition of FCS may increase the FceRIa expression on cord blood-derived mast cells. 2. Although they may...
Histamine Release From Human CBDMCs by Crosslinkage of FceRI With Myeloma IgE
3.1.1. Crosslinkage of FceRI With Myeloma IgE and Anti-Human IgE 1. Human CBDMCs are developed from human cord blood and maintained in CBDMC media for approx 8-16 wk or until mature 7 . 2. Pipet 10 mL of CBDMC 5 x 105 cells mL in CBDMC media into each of the 75-cm2 flasks. Treat CBDMC with 0 or 2 p,g mL final concentration of myeloma IgE by adding 0 media control or 20 p.L of myeloma IgE 1 mg mL to the flask, and incubate at 37 C in a 5 CO2 incubator overnight. 3. Pipet myeloma IgE-treated...
of Mast CellEndothelial Cell Interaction
The interaction of mast cells with endothelial cells and the fate of MCG can be documented by scanning and transmission electron microscopy. 1. HCAECs are cultured on sterile cover slips inserted in six-well culture plates for 24 h in the presence or absence of purified mast cells at a mast cell endothelial cell ratio of 1 2. 2. After 24 h, the cells are washed twice with phosphate-buffered saline. The cells are then fixed in 2 glutaraldehyde, and processed for scanning electron microscopy Fig....
References Utl
1. Schwartz, L. B., Irani, A. A., Roller, K., Castells, M. C., and Schechter, N. M. 1987 Quantitation of histamine, tryptase and chymase in dispersed human T and TC mast cells. J. Immunol. 138, 2611-2615. 2. Galli, S. J. 1993 New concepts about the mast cell. N. Engl. J. Med. 328, 257-265. 3. Reynolds, D. S., Gurley, D. S., Stevens, R. L., Sugarbaker, D. J., Austen, K. F., and Serafin, W. E. 1989 Cloning of cDNAs that encode human mast cell car-boxypeptidase A, and comparison of the protein...
Tissue Preparation for ParaffinEmbedded Tissue
Formalin-fixed tissue is processed with a standard procedure, which includes dehydration, clearing, infiltration, and embedding. Dehydration is necessary in the preparation of tissue blocks for embedding in a nonaqueous medium, such as paraffin, celloidin, and some plastics. These media will not infiltrate tissue that contains water. There are two ways in which the dehydrating agents act to remove water. Some reagents are hydrophilic and attract water from tissue, whereas other reagents...
Alexander W Hauswirth Stefan Florian GeritHolger Schernthaner MariaTheresa
During the past few decades, a number of functionally important cell surface antigens have been detected on human mast cells MCs . These antigens include the stem cell factor receptor SCFR CD117 , the high-affinity immunoglobulin E receptor, adhesion molecules, and activation-linked membrane determinants. Several of these antigens CD2, CD25, CD35, CD88, CD203c appear to be upregulated on MCs in patients with systemic mastocytosis and therefore are used as diagnostic markers. Quantitative...
Materials Pqe
1. Fresh human plasma from normolipidemic subjects. 2. Density solution 1.006 g mL add 12.46 g of KBr to 5 mL of a 10 solution of ethylene diamine tetraacetic acid EDTA and bring volume to 1 L. 3. Density solution 1063 g mL add 91.98 g of potassium bromide KBr to 5 mL of a 10 solution of EDTA and adjust the volume to 1 L. 4. LDL dialysis buffer phosphate-buffered saline PBS 0.01 M sodium phosphate, 0.15 M NaCl, and 0.01 EDTA, pH 7.4. 5. Dialysis tubing spectrapor membrane tubing, 10,000 MW...
Activation of Mast Cells by oxLDL
3.3.1. Experimental Setup to Measure Activation of Mast Cells by oxLDL 1. Dispense the cultured HMC-1 into 60 x 15-mm culture dishes with a final concentration of 2 million cells in a total volume of 2 mL. Fig. 1. Agarose electrophoresis of LDL and oxLDL. Lipoproteins were stained with Oil Red O. OxLDL migrates four times faster than LDL. Fig. 1. Agarose electrophoresis of LDL and oxLDL. Lipoproteins were stained with Oil Red O. OxLDL migrates four times faster than LDL. 2. Incubate the cells...
Generation of BMMCS
Here we describe our standard procedures for BMMC generation, which usually takes 4-6 wk see Note 1 . After this period, mast cells constitute more than 95 of live cells, as assessed by flow cytometry for positive expression of FceRI and c-Kit. With this high percentage, the cells are ready for biological e.g., assays for degranulation, leukotriene, and cytokine secretion , biochemical e.g., kinase assays, phosphatase assays, GTPase measurement, and so on , genetic e.g., cDNA transfection,...
Zhenhong Qu
The relative rarity of mast cells MCs and the rich content of heparin in the cytoplasmic granules of MCs pose technical challenges in reliably detecting growth factors GFs or cytokines in MCs by conventional immunohistological stain IHS methods. A variety of polypeptide growth factors are characterized by high-affinity to heparin. Binding of GFs to MC granules during detection can lead to highly specific yet falsely positive results that cannot be easily discovered by conventional procedure...
Enrichment of Intestinal Mast Cells by Positive Selection Using Magnetic Cell
Enrichment of human intestinal mast cells can be performed by using magnetic cell sorting MACS . In general, mast cells are 50-75 pure after positive sorting by immunomagnetic labeling of c-kit 15,16 . In some cell preparations, the purity can be greater than 90 . Further purification, as much as 100 , is possible by culture of the cells see Subheading 3.3. . Although this method is a powerful tool for the enrichment of human intestinal mast cells it has also some limitations 1 recovery of the...
Acknowledgments Tsf
We are grateful to Dr. Honjo, Osaka University Medical School, Japan, for the kind gift of the IgE cDNA. Our work is supported by grants from the Canadian Institute of Health Research and the Multiple Sclerosis Scientific Research Foundation. J.F.G. is a Canada Research Chair recipient. 1. Geha, R. S., Jabara, H. H., and Brodeur, S. R. 2003 The regulation of immunoglobulin E class-switch recombination. Nat. Rev. Immunol. 3, 721-732. 2. Gauchat, J. F., Lebman, D. A., Coffman, R. L., Gascan, H.,...
FceRI Stimulation in BMMC
2. Transfer the cells to 200-mL centrifuge tubes or 50-mL tubes. 3. Spin down the cells at 300g for 5 min. 4. Resuspend the cells in BMMC medium to a density of 2 x 106 mL. 5. Add IgE to a final concentration of 0.5 g mL. 6. Incubate overnight in a CO2 incubator. 1. Spin down the cells in a 50-mL tube for 5 min at 300g. 2. Wash once in Tyrode's buffer. 3. Resuspend the cells in Tyrode's buffer to 2 x 107 cells mL. 5. Add antigen DNP-HSA to a final concentration of 10-100 ng mL. 6. Incubate at...
Materials Coa
1. Human coronary artery endothelial cells HCAECs Cambrex, San Diego, CA . 2. Endothelial growth media EGM-2 Cambrex . 3. Minimum essential medium with Eagle's salts HMEM minimum essential medium Hyclone, Hogan, UT containing 15 mM acid HEPES , 100 U mL penicillin, 100 pg streptomycin, 10 fetal bovine serum FBS , and 5 U mL heparin Sigma, St. Louis, MO . 4. Low-endotoxin FBS Hyclone, Hogan, UT . 7. EGM-2MV containing 1 pg mL hydrocortisone acetate, 50 ng mL gentamycin, 50 pg mL amphotericin B,...
Confirmation of the Interaction of Molecules by CoImmunoprecipitation
Protein interactions identified in yeast two-hybrid screens require validation in another system. The protein-protein interaction can be confirmed by co-immunoprecipitating the original bait protein with the newly identified interactor from cellular lysates. The yeast vector used for the cDNA library in the yeast two-hybrid screen is not suitable for protein expression, so the interactors of interest are subcloned into an E. coli expression vector. The recombinant protein is then used for...
Setting Up and Calibrating the Luminex 100 System
Before running the Bio-Plex 17-plex cytokine assay on the Luminex 100 instrument, it is necessary to perform the start-up maintenance and instrument calibration procedure. These procedures are briefly described in Subheadings 3.2.1. and 3.2.2. 3.2.1. Setting Up the the Luminex 100 System 1. Turn on the Luminex 100 instrument, XY platform and the Luminex SD Sheath Delivery System and start the Luminex data acquisition software and initiate the warmup feature to allow the optics to properly...
Introduction Eno
The late-phase reaction LPR is a model for chronic allergic inflammation for many reasons, including the pattern of cellular influx. Specifically, an influx of eosinophils, monocytes, and basophils occurs, and these cells are known to be activated and hyper-responsive to stimuli 1,2 . Although many characteristics of the LPR are well documented, the stimulus for the activation of basophils, as well as the reason why only some allergic individuals have a LPR are still unclear. Since Theueson et...
Mast Cell Activation and Mediator Production
Human mast cells and basophils express the receptor for IgE, FceRI 2 . FceRI in contrast to the other receptor for IgE, FceRII binds IgE with high affinity 22 . The other receptor for IgE, FceRII, has been detected on eosino- phils, mononuclear cells, lymphocytes, and platelets. FceRI is a multimeric complex composed of four chains, designated as a which has the IgE-binding domain , P, and the two disulfide-linked y chains 23,24 . Typically, multivalent antigen binds to IgE, which in turn binds...
Mediator Release and Cytokine Production in Human Intestinal Mast Cells
In the gut, mast cells produce histamine, neutral proteases, and eicosanoids mediating various functions such as smooth muscle contraction, leukocyte extravasation, ion and mucus secretion, and degradation of peptides. In addition, intestinal mast cells produce multiple cytokines and growth factors, such as TNF-a, IL-1p, IL-3, IL-5, IL-6, IL-8, IL-13, IL-16, IL-18, transforming growth factor TGF -P1, basic fibroblast growth factor, and others 10,13,18,20, 23 . These findings emphasize their...
Protocol for Silencing siRNA Construction
This subheading is modified from Ambion siRNA construction kit instruction. 3.1.1. siRNA Design Elbashir et al. 19 indicate that the most siRNAs are affected by 21-nt dsRNAs with 3' overhanging dimers of uridine. 3.1.1.1. Examples of siRNA Oligonucleotide Template Design 5'- AACCCGCGGAGCUGCCUGCCU-3' Antisense siRNA oligonucleotide template 5'- AACCCGCGGAGCTGCCTGCCTCCTGTCTC -3' Sense siRNA oligonucleotide template 5'- AAAGGCAGGCAGCTCCGCGGGCCTGTCTC -3' 5'-AAGCGGCAGCGGGCACUGAUG-3' Antisense siRNA...
Identification of the Cellular Content of Healing Infarcts
During the proliferative phase of healing, infarcts contain a large number of inflammatory, vascular, and matrix-producing cells. To study the cellular environment in healing infarcts, we developed immunohistochemical methods to identify cell types often associated with mast cells in healing tissues. This section describes immunohistochemical techniques to label neutrophils, macrophages, endothelial cells, fibroblasts, and smooth muscle cells in normal and infarcted canine hearts. 3.2.1...
Introduction Gyz
The challenge in developing a reliable and reproducible detection method for growth factors GFs in tissue mast cells MCs arises from two aspects of MC biology. The first is the relative rarity of MCs in most types of tissue and their morphological ambiguity on routine hematoxylin-eosin H amp E stain, which makes it very difficult to appreciate the magnitude of MC infiltration and to reliably attribute a positive stain for a growth factor to MCs. The second From Methods in Molecular Biology,...
In Vitro Kinase Assays
Two representative methods will be described here one is an assay on Btk, in which reaction products are analyzed by SDS-PAGE and followed by blotting, and the other is an assay on Akt, in which reaction products are blotted onto phosphocellulose filters followed by counting the radioactivity. Both methods can be adapted for other PTKs and PS TKs using proper substrates and kinase reaction conditions see Note 6 . These methods are also easy to be adapted when different sources of enzyme, for...
M E T H O D S I N M O L E C U L A R B I O L O G Y
Quillen College of Medicine, James H. Quillen Veterans Affairs Medical Center, East Tennessee State University, Johnson City, TN 2006 Humana Press Inc. 999 Riverview Drive, Suite 208 Totowa, New Jersey 07512 All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher. Methods in Molecular Biology is a...
Ido Bachelet Ariel Munitz and Francesca LeviSchaffer
Mast cell development, function, and survival are likely to be regulated by a complex interplay of cellular signaling. Usually, these signals derive from the cellular milieu associated with the specific mast cell environment in health or disease conditions. A major methodological issue in studying in vitro mast cells, as well as any other tissue dwelling cell, is the essential lack of all the tissue-derived signals. Because some of the signals can be unknown, the in vivo system they form is...
Phenotyping of Bone Marrow MCs
Bone marrow MCs usually are incubated with MAbs in heparinized samples shortly after aspiration without a preceding isolation step or separation from erythrocytes. This procedure has been recommended because bone marrow MCs often are lost in Ficoll separation steps or prior erythrocyte lysis 15,16,20,21 . In select cases patients with high-grade MC diseases, e.g., MC leukemia , MCs also can be enriched by Ficoll isolation without loss of a considerable number of MCs. In low-grade MC disease,...
Culture of the Human Mast Cell Line HMC1
The human mast cell line HMC-1 9 kindly provided by Dr. J. H. Butterfield, Mayo Clinic, Rochester, MN was grown in mast cell culture media using standard sterile technique. Cells are counted and then seeded in culture flasks at a density of 20,000 cells mL of media and recultured every 4 d. HMC-1 grow in suspension and their numbers double approximately every 24 h. Cell viability is measured using trypan blue exclusion and is usually greater than 95 . See Chapter 16 for more information on the...
Griess Reagent Assay for Nitrite Only in Culture Medium
1. Cells are grown in 96-well microplates with tissue culture medium containing RPMI-1640 without phenol red and 10 FBS. The culture medium is made by mixing 45.0 mL of RPMI-1640, 5.0 mL FBS, and 0.25 mL of penicillin-streptomycin. 2. After 4 to 18 h of incubation 5 CO2, 95 air at 37 C , a 50-pL aliquot of the cell culture medium containing the nitrite to be assayed is transferred to a new 96-well plate containing 50 pL of Griess reagent a and 50 pL of Griess reagent b per well see Notes 3 and...
Notes Ijz
1. Tissue can be obtained from all parts of the bowel. Most specimens we have obtained have come from patients who underwent resection because of large bowel cancer. 2. Tissue can be stored at 4 C overnight, although immediate processing is preferential. In our hands, numbers and viability of isolated mast cell are only slightly impaired after overnight storage of the tissue specimen. 3. Tissue suspension needs to be stirred using a tweezer or with other appropriate instruments to avoid...
Griess Reagent Assay for Nitrite Plus Nitrate in Culture Medium
The Griess assay measures only nitrite, yet it is important to measure total nitrite plus and nitrate since both are produced by NO in aqueous conditions. This can be accomplished by adding bacterial nitrate reductase and NADPH to reduce nitrate to nitrite, that is, NO3- NADPH NO2- NADP H2O. This, however, creates a new analytical problem since any excess NADPH interferes with the Griess reaction. Fortunately, the excess NADPH can be removed by using an enzymatic reaction consuming NADPH such...
Materials Xid
1. Culture media see Table 1. All the reagents were supplied from Biological Industries, Beth Haemek, Israel. 2. Cytokines, growth factors, antibodies see Table 2. Fig. 1. Electron micrograph of rat peritoneal mast cells MC co-cultured with Swiss Albino 3T3 fibroblasts FB for 8 d 11 . Fig. 1. Electron micrograph of rat peritoneal mast cells MC co-cultured with Swiss Albino 3T3 fibroblasts FB for 8 d 11 . Culture media Supplements required DMEM 4.5 g L glucose 10 v v, FCS heat inactivated 100 U...
Mediator Release
3. MAb 22E7 provided by Hoffmann-La Roche directed against a non-IgE binding epitope of the high affinity IgE receptor chain. 4. HACM-buffer HA-buffer see Subheading 2.1. , 1 mM CaCl2, 1 mM MgCl2, store at 4 C. 5. Cytokine enzyme-linked immunosorbent assay ELISA, e.g., R amp D, Biosource . 6. Histamine radioimmunoassay Coulter Immunotech, cat. no. IM2588 . 7. Sulfidoleukotriene sLT LTC4 D4 E4 RIA Biotrend, cat. no. 900070 . 8. Prostaglandin D2 PGD2 ELISA Cayman Chemical, cat. no. 512011 . 9....
Performance of the BioPlex Human 17Plex Cytokine Assay
1. Luminex 100 system with XYZ platform Luminex, Austin TX . 2. Bio-Plex Human Cytokine 17-Plex Panel Bio-Rad, Hercules, CA . 3. Bio-Plex Buffer kit for assay Bio-Rad Laboratories . 4. Titer Plate Orbital Shaker Lab-line, Melrose Park, IL. . 5. Millipore MultiScreen Resist Vacuum Manifold, MAVM0960R Millipore, Billerica, MA . 6. Thermodine Maxi Mix II Vortexer, M37615 Mixer, Barnstead International, Dubuque, IA . 7. Mini Ultrasonik sonicator Dentsply Ceramco, Burlington, NJ . 8. 55 mL of...
Roles of Mast Cells in Asthma
Allergic asthma is a chronic disease of the respiratory tract 41 . It is characterized by relapsing-remitting episodes of reversible airway obstruction. Clinical symptoms include shortness of breath, wheezing, chest discomfort, and coughing, which can lead to respiratory failure. Eosinophilia, lung inflammation, elevated serum IgE, mucus hypersecretion, and hyperreactive airways are typical. Like immediate hypersensitive responses, allergens elicit the initial symptoms, and mast cell mediators...
Chuanfu Li Jim Kelley and Tuanzhu Ha
Nuclear factor-kB NF-kB is a key transcription factor that regulates the expression of genes involved in immune and inflammatory responses and in cell death and survival. This chapter describes in detail the method for measuring the NF-kB binding activity in the cultured human mast cell line HMC-1 using the electrophoretic mobility shift assay the activation of NF-kB was illustrated by adding lipopolysaccharide to mast cells, nuclear proteins were isolated, and the NF-kB binding activity was...
Hirohisa Saito
The survival of hemopoietic stem cells in culture is suppressed by various cytokines and stimuli. The development of human mast cells also is affected by these stem cell-inhibitory mechanisms because it requires a much-longer period as compared with the development of other cell lineages. This chapter introduces the method of forming human mast cell colonies by culturing purified cord blood cells and peripheral blood cells in serum-free methylcellulose supplemented with stem cell factor and...
Nikolaos G Frangogiannis and Mark L Entman
Myocardial infarction is associated with an acute inflammatory response, leading to replacement of injured cardiomyocytes with granulation tissue. Mast cells are actively involved in postinfarction inflammation by releasing histamine and tumor necrosis factor-a, triggering a cytokine cascade. During the proliferative phase of healing, mast cells accumulate in the infarct and may regulate fibrous tissue deposition and angiogenesis by releasing growth factors, angiogenic mediators, and proteases....
Introduction Avs
Human mast cells contain three serine proteases in their granules that are released upon degranulation. Most, if not all, mast cells contain tryptase, and some mast cells also contain chymase 1 . Additionally, cathepsin G, which is normally thought of as a component of neutrophils, also has been shown to be present in mast cells 2,3 . The activities of these proteolytic enzymes add additional functions to the mast cell. Consequently, the measurement of these enzyme activities is critical to...
Histamine Release From Human CBDMCs by Crosslinkage of FceRI With Myeloma IgE
2.1.1. Crosslinkage of FceRI With Myeloma IgE and Anti-Human IgE 1. Human CBDMC media DMEMF12 Gibco Invitrogen, Carlsbad, CA supplemented with 20 fetal bovine serum Atlanta Biologicals, Atlanta, GA 5 x 10-5 M 2-mercaptoethanol Fisher, Pittsburgh, PA 0.5 mL of insulin-transferin-sodium selenite solution Sigma-Aldrich, St. Louis, MO 25 mM HEPES Gibco, Carlsbad, CA 300 nM PGE2 Cayman, Ann Arbor, MI 100 ng mL recombinant human IL-6 kindly provide by Amgen, Thousand Oaks, CA and 80 ng mL stem cell...
Shruti A Shukla Ranjitha Veerappan Judy S Whittimore Lou Ellen Miller and
Mast cells are bone marrow-derived cells that are widely distributed in the tissue. They are found predominantly in the subepithelial tissue near blood vessels and nerves and usually are sprinkled diffusely without forming clusters. In tissue sections stained with hematoxylin and eosin, normal mast cells usually display a round-to-oval nucleus with clumped chromatin and indistinct or no nucleoli. They have moderately abundant cytoplasm and are oval, spindle, or polygonal in shape. The cytoplasm...
EMSA for NFkB Binding Activity
The procedures for the binding reaction include the following incubate the nuclear extracts with y-32P ATP-labeled oligonucleotide probe that contains the specific binding sequence for NF-kB the binding reaction occurs under specific salt pH conditions in a binding buffer . Add Poly-dIdC into the binding reaction mixtures to prevent nonspecific binding of proteins to the NF-kB oligonucleotide probe. Determine the subunits of NF-kB binding activity in the nuclear extracts by competition assay...
Effect of IL3 and GMCSF on Mast Cell Development in the Presence of SCF and IL6
IL-3 and GM-CSF have strong homology in their amino acid sequences and share the common receptor P-chain CD131. GM-CSF inhibits the mast cell development both in mouse 11 and human systems 6 , whereas the effect of IL-3 on the human mast cell development is still controversial. IL-3 is not required for the development of cord blood-derived mast cells in the presence of oxygen at a low concentration 7 . However, IL-3 enhances the SCF-depen-dent development of mast cells at low cell densities...
HMC Histochemical Stains
HMC numbers are calculated by determining the percentage of acidic toluidine blue positive cells out of total Wright-Giemsa-positive cells. Acidic tolui-dine blue-positive HMC numbers can be confirmed by tryptase staining. 1. Count cells directly out of flasks, and concentrate at 210g for 5 min to at least 2 x 105 cells mL, for optimal cytospins. 2. Add 100 pL of cell suspension to cytospin sample chambers and clean slides. Spin slides at 14g for 5 min. Let slides air dry and place on an...
Kinase Assays
1. Lysis buffer 1 Nonidet-P40 NP-40 lysis buffer 1 Igepal CA-630 Sigma see Note 2 , 20 mM Tris-HCl, pH 7.5, 0.15 M NaCl, and 0.1 NaN3. 2. Inhibitors all from Sigma add inhibitors to the lysis buffer right before use. 1 mM Na3VO4, 1 mM phenylmethyl sulfonyl fluoride, 1 g mL aprotinin, 1 g mL leupeptin, 1 M pepstatin, 25 M p-nitrophenyl p'-guanidinobenzoate, 2 mM NaF. 3. 5X sodium dodecyl sulfate-polyacrylamide gel electrophoresis SDS-PAGE sample buffer 0.5 M dithiothreitol DTT , 10 SDS, 0.4 M...
Preparation for Methylcellulose Culture
1. Silica silicon gel Immuno Biological Laboratories, Fujioka, Japan . 2. Lymphocyte Separation Medium Organon Teknika Corp. Durham, NC . 3. Magnetic separation column MACS II, cat. no. 441-01, Miltenyi Biotec, Bergisch Gladbach, Germany . 4. CD4, CD8, CD11b, CD14, and CD19-conjugated MACS beads Miltenyi Biotec . 5. CD34 cell isolation kit Miltenyi Biotec see Note 1 . 6. Iscove's modified Dulbecco's medium IMDM GIBCO, cat. no. 12440-053, Invitrogen Co., Carlsbad, CA . 7....
Performance of the Human BioPlex 17Plex Cytokine Assay
Samples were prepared and assayed according to the Bio-Plex cytokine assay instruction manual 22 with modifications. Permission was granted by Bio-Rad Laboratories to reproduce the assay protocol as a part of the sample preparation section. The protocol listed below reflects material preparation necessary to perform an entire 96-well microtiter plate on cell culture supernatants. 1. Twelve hours before the assay, remove the samples and aliquoted sample medium from the -80 C freezer and place...
Retroviral Transduction of BMMCS
This section can be divided into 1 the construction of retroviral expression vector 2 the generation of recombinant retrovirus and 3 the infection of replicating mast cells with recombinant retrovirus see Note 4 . 3.2.1. Construction of Retroviral Vector A Moloney murine leukemia virus-based vector, pMX-puro 8,9 , has been extensively used for transfection of mouse BMMC. As almost all gene-targeted mice have a neo gene cassette in their genome, the retroviral vector must have a different...
Isolation and Oxidative Modification of Human Plasma LDL
Blood is collected from healthy fasting volunteers by venipuncture into tubes containing 1.5 mg of EDTA per milliliter of blood. Blood is centrifuged at 2000g for 10 min to separate the plasma from the cellular components of the blood. Lipoproteins are separated from plasma by sequential ultracentrifugal flotation as described in detail 10 . 1. Fill Beckman OptiSeal tubes with fresh human plasma and place the tubes into a Beckman Type 80 Ti rotor see Note 1 . 2. Centrifuge the plasma, which has...
TsungHsien Tsai Denise M Milhorn and ShauKu Huang
Human mast cells are capable of secreting a plethora of inflammatory mediators and cytokines that may play a pivotal role in innate immune and inflammatory responses. Activation of mast cells by antigen and immunoglobulin E IgE results in signaling, gene expression, and expression of inflammatory mediators. Although a variety of techniques have been used to evaluate mast cell biology, recent advances in molecular techniques have provided unprecedented tools to study these cells. The...
Staining Tissue With Hematoxylin and Eosin
Harris hematoxylin stains specimens rapidly with very good results. A commonly used stain is 4 mL of glacial acetic acid added to every 96 mL of Harris hematoxylin see Note 4 . In the progressive method, slides are first stained with hematoxylin, which stains only the nucleus, then rinsed and stained with eosin 21-23 . The regressive method uses a stronger hematoxylin dye that stains the entire cell and an acid alcohol solution is used to remove the excess stain such that only the nucleus...